######
        Clean data of 23 samples in format of *.fq.gz

1.      *.fq [12].gz ---fastq file format

@A201GMABXX:5:1:14057:2058#GATCAG/1
GCTATCCAGTGAGTCCTGCAAGACTTCAGGCTCTACTACCTCCAGCAG
+
Feffffafffecffffffffeffffceefffcddffeecfcadddddd
Format description:
A FASTQ file normally uses four lines per sequence. Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line). Line 2 is the raw sequence letters. Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.

######