MAST -- Motif Alignment and Search Tool

Motif search tool

---

Search Results

The MAST results consist of

• The inputs to MAST including:
  1. The sequence databases showing the sequence and residue counts. [View]
  2. The motifs showing the name, width, best scoring match and similarity to other motifs. [View]
• The search results showing top scoring sequences with tiling of all of the motifs matches shown for each of the sequences. [View]
• The program details including:
  1. The version of MAST and the date it was released. [View]
  2. The reference to cite if you use MAST in your research. [View]
  3. The command line summary detailing the parameters with which you ran MAST. [View]
• An explanation of how to interpret MAST results. [View]

Match Scores

The match score of a motif to a position in a sequence is the sum of the score from each column of the position-dependent scoring matrix corresponding to the letter at that position in the sequence. For example, if the sequence is

             TAATGTTGGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGC
                ========
            

and the motif is represented by the position-dependent scoring matrix (where each row of the matrix corresponds to a position in the motif)

Position	A	C	G	T
1	1.447	0.188	-4.025	-4.095
2	0.739	1.339	-3.945	-2.325
3	1.764	-3.562	-4.197	-3.895
4	1.574	-3.784	-1.594	-1.994
5	1.602	-3.935	-4.054	-1.370
6	0.797	-3.647	-0.814	0.215
7	-1.280	1.873	-0.607	-1.993
8	-3.076	1.035	1.414	-3.913

then the match score of the fourth position in the sequence (underlined) would be found by summing the score for T in position 1, G in position 2 and so on until G in position 8. So the match score would be

               score = -4.095 + -3.945 + -3.895 + -1.994
                       + -4.054 + -0.814 + -1.933 + 1.414 
                     = -19.316
            

The match scores for other positions in the sequence are calculated in the same way. Match scores are only calculated if the match completely fits within the sequence. Match scores are not calculated if the motif would overhang either end of the sequence. Note: Scores for any IUPAC ambiguous characters appearing in a sequence are calculated as the weighted average of the scores of letters that match the ambiguous character. The weights are the background frequencies of the letters specified to MAST.

P-values

MAST reports all matches of a sequence to a motif or group of motifs in terms of the p-value of the match. MAST considers the p-values of four types of events:

• position p-value: the match of a single position within a sequence to a given motif,
• sequence p-value: the best match of any position within a sequence to a given motif,
• combined p-value: the combined best matches of a sequence to a group of motifs, and
• E-value: observing a combined p-value at least as small in a random database of the same size.

All p-values are based on a random sequence model that assumes each position in a random sequence is generated according to the average letter frequencies of all sequences in the database being searched.

Input Database and Motifs

This section shows information on the database that was searched and the motifs in the search query. The database section [View] gives the date the database was last updated as well as the number of sequences and total sequence characters in it. The motifs [View] are listed by motif number. The width and subsequence which would be given the best possible score for each motif is shown. If there is more than one motif in the query, all pairwise correlations between the motifs are shown. The correlations can range from -1 to +1, with +1 meaning that the shorter motif is exactly identical to part or all of the longer motif. High correlations can cause some combined p-values and E-values to be inaccurate (too low). It may be advisable to remove enough motifs from the query to insure that no pairs of motifs have high correlations. Any high correlations are indicated along with the suggestion that one of the motifs be removed from the query.

Top Scoring Sequences

MAST lists the names, E-values, link to expanded results and motif block diagram of all sequences whose E-value is less than the set threshold. Sequences shorter than one or more of the motifs are skipped. The sequences are sorted by increasing E-value. The E-value threshold is set to 10 for the web server by default.

Motif Block Diagrams

Motif block diagrams show the order and spacing of non-overlapping matches to the motifs in each high-scoring sequence. Motif occurrences are determined based on the position p-value of matches to the motif. For each high scoring sequence the in the output, diagrams are shown like this:

The vertically central line shows the extent of the sequence relative to the lengths of the other sequences in the database. The ruler at the bottom gives an indication of the actual length of the sequence. The coloured blocks are motif occurrences. Blocks above the line are on the given strand, blocks below the line are on the reverse complement strand (DNA only). The colour and border of the block can be used to identify the motif by using the legend. The height of the block can be used to get an indication of the significance of the match with taller blocks being more significant. If you place the mouse cursor over any of the motif blocks then the "title" text will be displayed. It lists the name of the motif, the p-value of the occurrence, the frame (translated DNA only) and the extent.

Expanded Results

By clicking a link next to the E-value the expanded results become visible. The expanded results include the sequence comment, combined p-value, the best frame (for translated sequences) and the annotated sequence.

Annotated Sequences

In the expanded results view, MAST shows an annotated sequence by printing the sequence along with the position and strength of all the non-overlapping motif occurrences for a user selectable portion of the sequence. Dragging the buttons below the motif block diagram modifies the visible portion of the annotated sequence. The four lines above each motif occurrence contain, respectively,

• the motif name of the occurrence,
• the position p-value of the occurrence,
• the best possible match to the motif, and
• a plus sign (`+') above each letter in the occurrence that has a positive match score to the motif.

The best possible match to a motif is the sequence of letters which would achieve the highest match score.

When peptide motifs are used to search nucleotide sequences, the reading frame (a, b or c) of each match is indicated with the motif name and the peptide translation of the matching sequence is shown just above the motif occurrence.

Sample MAST Search Results

Here is an actual MAST search results file of a search of a peptide database with peptide motifs.