\n" ">chr22:31000551+31001000 TAACAGATTGATGATGCATGAAATGGG CCCATGAGTGGCTCCTAAAGCAGCTGC\n" "TtACAGATTGATGATGCATGAAATGGGgggtggccaggggtggggggtga\n" "gactgcagagaaaggcagggctggttcataacaagctttgtgcgtcccaa\n" "tatgacagctgaagttttccaggggctgatggtgagccagtgagggtaag\n" "tacacagaacatcctagagaaaccctcattccttaaagattaaaaataaa\n" "gacttgctgtctgtaagggattggattatcctatttgagaaattctgtta\n" "tccagaatggcttaccccacaatgctgaaaagtgtgtaccgtaatctcaa\n" "agcaagctcctcctcagacagagaaacaccagccgtcacaggaagcaaag\n" "aaattggcttcacttttaaggtgaatccagaacccagatgtcagagctcc\n" "aagcactttgctctcagctccacGCAGCTGCTTTAGGAGCCACTCATGaG\n" "\n" "The + between the coordinates in the fasta header indicates \n" "this is on the positive strand. \n" ); } #define ORGFORM_KEEP_ORG "document.orgForm.org.value = " \ " document.mainForm.org.options[document.mainForm.org.selectedIndex].value; " #define ORGFORM_KEEP_DB " document.orgForm.db.value = " \ " document.mainForm.db.options[document.mainForm.db.selectedIndex].value; " #define ORGFORM_KEEP_PARAMS \ " document.orgForm.wp_f.value = document.mainForm.wp_f.value; " \ " document.orgForm.wp_r.value = document.mainForm.wp_r.value; " \ " document.orgForm.wp_size.value = document.mainForm.wp_size.value; " \ " document.orgForm.wp_perfect.value = document.mainForm.wp_perfect.value; " \ " document.orgForm.wp_good.value = document.mainForm.wp_good.value; " #define ORGFORM_RESET_DB " document.orgForm.db.value = 0; " #define ORGFORM_RESET_TARGET " document.orgForm.wp_target.value = \"\"; " #define ORGFORM_SUBMIT " document.orgForm.submit();'"; void showGenomes(char *genome, struct pcrServer *serverList) /* Put up drop-down list with genomes on it. */ { struct hash *uniqHash = hashNew(8); struct pcrServer *server; char *onChangeText = "onchange='" ORGFORM_KEEP_PARAMS ORGFORM_KEEP_ORG ORGFORM_RESET_DB ORGFORM_RESET_TARGET ORGFORM_SUBMIT; printf("\n"); hashFree(&uniqHash); } void showAssemblies(char *genome, char *db, struct pcrServer *serverList, boolean submitOnClick) /* Put up drop-down list with assemblies on it. */ { struct pcrServer *server; char *onChangeText = "onchange='" ORGFORM_KEEP_PARAMS ORGFORM_KEEP_ORG ORGFORM_KEEP_DB ORGFORM_RESET_TARGET ORGFORM_SUBMIT; printf("\n"); } void showTargets(char *target, struct targetPcrServer *serverList) /* Put up drop-down list with targets on it. */ { struct targetPcrServer *server; printf("\n"); } void redoDbAndOrgIfNoServer(struct pcrServer *serverList, char **pDb, char **pOrg) /* Check that database and organism are on our serverList. If not, then update * them to first thing that is. */ { struct pcrServer *server, *orgServer = NULL; char *organism = *pOrg; char *db = *pDb; boolean gotDb = FALSE; /* Find first server for our organism */ for (server = serverList; server != NULL; server = server->next) { if (sameString(server->genome, organism)) { orgServer = server; break; } } /* If no server, change our organism to the one of the first server in list. */ if (orgServer == NULL) { orgServer = serverList; *pOrg = organism = orgServer->genome; } /* Search for our database. */ for (server = serverList; server != NULL; server = server->next) { if (sameString(db, server->db)) { gotDb = TRUE; break; } } /* If no server for db, change db. */ if (!gotDb) { if (differentString(db, orgServer->db)) printf("
Note: In-Silico PCR is not available for %s %s; " "defaulting to %s %s
In-Silico PCR was written by " "Jim Kent.\n" "Interactive use on this web server is free to all.\n" "Sources and executables to run batch jobs on your own server are available free\n" "for academic, personal, and non-profit purposes. Non-exclusive commercial\n" "licenses are also available. Contact Jim for details.
\n"); } void writePrimers(struct gfPcrOutput *gpo, char *fileName) /* Write primer sequences to file. Look at only the first gpo because there * is only one set of primers in the input form. */ { if (gpo == NULL) return; FILE *f = mustOpen(fileName, "w"); fprintf(f, "%s\t%s\n", gpo->fPrimer, gpo->rPrimer); carefulClose(&f); } void writePcrResultTrack(struct gfPcrOutput *gpoList, char *db, char *target) /* Write trash files and store their name in a cart variable. */ { char *cartVar = pcrResultCartVar(db); struct tempName bedTn, primerTn; char buf[2048]; trashDirFile(&bedTn, "hgPcr", "hgPcr", ".psl"); trashDirFile(&primerTn, "hgPcr", "hgPcr", ".txt"); gfPcrOutputWriteAll(gpoList, "psl", NULL, bedTn.forCgi); writePrimers(gpoList, primerTn.forCgi); if (isNotEmpty(target)) safef(buf, sizeof(buf), "%s %s %s", bedTn.forCgi, primerTn.forCgi, target); else safef(buf, sizeof(buf), "%s %s", bedTn.forCgi, primerTn.forCgi); cartSetString(cart, cartVar, buf); } void doQuery(struct pcrServer *server, struct gfPcrInput *gpi, int maxSize, int minPerfect, int minGood) /* Send a query to a genomic assembly PCR server and print the results. */ { struct gfPcrOutput *gpoList = gfPcrViaNet(server->host, server->port, server->seqDir, gpi, maxSize, minPerfect, minGood); if (gpoList != NULL) { char urlFormat[2048]; safef(urlFormat, sizeof(urlFormat), "%s?%s&db=%s&position=%%s:%%d-%%d" "&hgPcrResult=pack", hgTracksName(), cartSidUrlString(cart), server->db); printf("");
gfPcrOutputWriteAll(gpoList, "fa", urlFormat, "stdout");
printf("");
writePcrResultTrack(gpoList, server->db, NULL);
}
else
{
printf("No matches to %s %s in %s %s", gpi->fPrimer, gpi->rPrimer,
server->genome, server->description);
}
}
void doTargetQuery(struct targetPcrServer *server, struct gfPcrInput *gpi,
int maxSize, int minPerfect, int minGood)
/* Send a query to a non-genomic target PCR server and print the results. */
{
struct gfPcrOutput *gpoList;
char seqDir[PATH_LEN];
splitPath(server->targetDb->seqFile, seqDir, NULL, NULL);
if (endsWith("/", seqDir))
seqDir[strlen(seqDir) - 1] = '\0';
gpoList = gfPcrViaNet(server->host, server->port, seqDir, gpi,
maxSize, minPerfect, minGood);
if (gpoList != NULL)
{
struct gfPcrOutput *gpo;
char urlFormat[2048];
printf("The sequences and coordinates shown below are from %s, "
"not from the genome assembly. The links lead to the "
"Genome Browser at the position of the entire target "
"sequence.");
for (gpo = gpoList; gpo != NULL; gpo = gpo->next)
{
/* Not used as a format here; we modify the name used for position: */
safef(urlFormat, sizeof(urlFormat), "%s?%s&db=%s&position=%s"
"&hgPcrResult=pack",
hgTracksName(), cartSidUrlString(cart), server->targetDb->db,
pcrResultItemAccession(gpo->seqName));
if (gpo->strand == '-')
printf("Warning: this amplification is on the reverse-"
"complement of %s.\n", gpo->seqName);
gfPcrOutputWriteOne(gpo, "fa", urlFormat, stdout);
printf("\n");
}
printf("");
writePcrResultTrack(gpoList, server->targetDb->db, server->targetDb->name);
}
else
{
printf("No matches to %s %s in %s", gpi->fPrimer, gpi->rPrimer,
server->targetDb->description);
}
}
boolean doPcr(struct pcrServer *server, struct targetPcrServer *targetServer,
char *fPrimer, char *rPrimer,
int maxSize, int minPerfect, int minGood, boolean flipReverse)
/* Do the PCR, and show results. */
{
struct errCatch *errCatch = errCatchNew();
boolean ok = FALSE;
hgBotDelay();
if (flipReverse)
reverseComplement(rPrimer, strlen(rPrimer));
if (errCatchStart(errCatch))
{
struct gfPcrInput *gpi;
AllocVar(gpi);
gpi->fPrimer = fPrimer;
gpi->rPrimer = rPrimer;
if (server != NULL)
doQuery(server, gpi, maxSize, minPerfect, minGood);
if (targetServer != NULL)
doTargetQuery(targetServer, gpi, maxSize, minPerfect, minGood);
ok = TRUE;
}
errCatchEnd(errCatch);
if (errCatch->gotError)
warn("%s", errCatch->message->string);
errCatchFree(&errCatch);
if (flipReverse)
reverseComplement(rPrimer, strlen(rPrimer));
webNewSection("Primer Melting Temperatures");
printf("");
printf("Forward: %4.1f C %s